SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


c-di-AMP-binding PII-like protein
11.83 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
c-di-AMP-binding PII-like protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    39,871 40,200

    The protein

    Effectors of protein activity

  • binds c-di-AMP [Pubmed|25433025]
  • Structure

  • [PDB|4RLE] (the ''B. subtilis'' protein in complex with c-di-AMP) [Pubmed|25433025]
  • Expression and Regulation


    view in new tab



  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B897 (yaaQ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1712 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''cat''), available in [SW|Jörg Stülke]'s lab [Pubmed|25433025]
  • GP1713 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2406 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2415 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2497 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE00290 ([gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT, downstream forward: _UP4_CATCAATTTTAAGGATCTGA
  • BKK00290 ([gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT, downstream forward: _UP4_CATCAATTTTAAGGATCTGA
  • Expression vectors

  • pGP2797: expression of ''darA'' (native RBS) by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • pGP3002: expression of ''darA'' (''gapA'' RBS) by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • pGP2601: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab [Pubmed|25433025]
  • pGP1690: IPTG inducible expression, purification in ''E. coli'' with N-terminal cleavable His-tag, in [SW|pGP570], available in [SW|Jörg Stülke]'s lab
  • pGP2624: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • pGP2602: expression of Strep-''darA'' by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP2603: expression of ''darA''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • GP2010: expression of ''darA''-Strep in ''B. subtilis'' (chromosomal), suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 25869574,32095817,32472931,32603625
  • Original publications

  • 22383849,25433025