SubtiBank SubtiBank
spoVAEB

spoVAEB

spore germinant protein, essential for the transport of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2+)
locus
BSU_23402
pI
6.25
mw
12.00 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
function
spore germination
product
spore germinant protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    2,440,423 2,440,773

    Expression and Regulation

    Operons

    genes
    [gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE23402 ([gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23402 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACAAAAGCCAAAAGGTAGT, downstream forward: _UP4_TTCAAACCGAAAGGATAATG
  • BKK23402 ([gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23402 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACAAAAGCCAAAAGGTAGT, downstream forward: _UP4_TTCAAACCGAAAGGATAATG
  • labs

  • [SW|Peter Setlow], University of Connecticut Health Center, USA
  • References

  • 17573930,3114420,11751839,15451103,3926949,17158659,6432957,7934830,22328679,15699190,1903432,8755877,22343299