SubtiBank SubtiBank
ydjP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydjP

similar to chloroperoxydase
locus
BSU_06280
pI
4.62
mw
30.36 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    681,547 682,362

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AD4702CC69AC7D5FF391F14176881D582DD1C68A|YvaM]:
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 23-257) (according to InterPro)
  • Structure

  • [PDB|4RNC] (from ''Rhodococcus sp.'', 28%(low identity!!!)
  • Expression and Regulation

    Operons

    genes
    [gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]-[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]-[gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C223 (ydjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2221 NBRP B. subtilis, Japan]
  • BKE06280 ([gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTCCTCCTTTAGT, downstream forward: _UP4_TAAAGAAAAAGGAATTAGGA
  • BKK06280 ([gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTCCTCCTTTAGT, downstream forward: _UP4_TAAAGAAAAAGGAATTAGGA
  • References

  • 9987136