SubtiBank SubtiBank
ydgK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydgK

similar to bicyclomycin resistance protein
locus
BSU_05680
pI
10.09
mw
42.52 kDa
protein length
402 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    613,641 614,849

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Bcr/CmlA family (single member, according to UniProt)
  • Structure

  • [PDB|2GFP] (from E. coli, 28% identity) [pubmed|16675700]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C176 (ydgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2174 NBRP B. subtilis, Japan]
  • BKE05680 ([gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCAAACCTTCCCT, downstream forward: _UP4_TAAAAAAACCTGACATGACG
  • BKK05680 ([gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCAAACCTTCCCT, downstream forward: _UP4_TAAAAAAACCTGACATGACG
  • References

    Research papers

  • 16675700