SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


component of the SpoIIIAH-SpoIIQ type III secretion system residing in the forespore membrane, required for anchoring of proteins on both sides of the sporulation septum, required for localization and stability of SpoIIE
30.96 kDa
protein length
283 aa Sequence Blast
gene length
849 bp Sequence Blast
forespore encasement by the spore coat
part of the transmembrane channel linking the mother cell and the forespore

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,759,702 → 3,760,553

    The protein

    Catalyzed reaction/ biological activity

  • required for forespore encasement by the spore coat [Pubmed|22171814]
  • required for the recruitment of [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] to the [SW|sporulation] septum on the mother cell side [Pubmed|23834622]
  • required for the proper localization and stability of [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] [Pubmed|26929302]
  • Structure

  • [PDB|3UZO]; [PDB|3TUF] (the [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]-[protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] pore forming complex) [Pubmed|22431604,22431613]
  • [SW|Localization]

  • membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH]) [Pubmed|22431604,22431613,22171814]
  • septal membranes on the forespore side [Pubmed|27381174]
  • proper [SW|localization] requires [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH], [protein|AA519F0D7DC94165C2CF5F7E230502D884898B71|GerM] and degradation of septal peptidoglycan by the cell wall hydrolases [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID] and [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] [Pubmed|23834622]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,9140963], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190,9140963]
  • view in new tab

    Biological materials


  • BKE36550 (Δ[gene|3282D2C25468776881778006F182FCF322C4821D|spoIIQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCATCACCTCAGC, downstream forward: _UP4_TAATGAAGAAAACGTCTATC
  • BKK36550 (Δ[gene|3282D2C25468776881778006F182FCF322C4821D|spoIIQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCATCACCTCAGC, downstream forward: _UP4_TAATGAAGAAAACGTCTATC
  • References


  • 23944268,25105965
  • Original publications

  • 18812514,15752199,18077456,18485064,15574594,15044948,15882622,19609349,9140963,20444098,17121846,18160039,21097616,16497325,15699190,22431613,22171814,23834622,22431604,23859254,25356555,26929302,27381174