SubtiBank SubtiBank
spoIIQ
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

spoIIQ

component of the SpoIIIAH-SpoIIQ type III secretion system residing in the forespore membrane, required for anchoring of proteins on both sides of the sporulation septum, required for localization and stability of SpoIIE
locus
BSU36550
pI
4.47
mw
30.96 kDa
protein length
283 aa Sequence Blast
gene length
849 bp Sequence Blast
function
forespore encasement by the spore coat
product
part of the transmembrane channel linking the mother cell and the forespore
essential
no
synonyms
ywnI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,759,702 → 3,760,553

    The protein

    Catalyzed reaction/ biological activity

  • required for forespore encasement by the spore coat [Pubmed|22171814]
  • required for the recruitment of [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] to the [SW|sporulation] septum on the mother cell side [Pubmed|23834622]
  • required for the proper localization and stability of [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] [Pubmed|26929302]
  • Structure

  • [PDB|3UZO]; [PDB|3TUF] (the [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]-[protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] pore forming complex) [Pubmed|22431604,22431613]
  • [SW|Localization]

  • membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH]) [Pubmed|22431604,22431613,22171814]
  • septal membranes on the forespore side [Pubmed|27381174]
  • proper [SW|localization] requires [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH], [protein|AA519F0D7DC94165C2CF5F7E230502D884898B71|GerM] and degradation of septal peptidoglycan by the cell wall hydrolases [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID] and [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] [Pubmed|23834622]
  • Expression and Regulation

    Operons

    genes
    [gene|3282D2C25468776881778006F182FCF322C4821D|spoIIQ]
    description
    [Pubmed|9140963]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,9140963], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190,9140963]
  • view in new tab

    Biological materials

    Mutant

  • BKE36550 (Δ[gene|3282D2C25468776881778006F182FCF322C4821D|spoIIQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCATCACCTCAGC, downstream forward: _UP4_TAATGAAGAAAACGTCTATC
  • BKK36550 (Δ[gene|3282D2C25468776881778006F182FCF322C4821D|spoIIQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCATCACCTCAGC, downstream forward: _UP4_TAATGAAGAAAACGTCTATC
  • References

    Reviews

  • 23944268,25105965
  • Original publications

  • 18812514,15752199,18077456,18485064,15574594,15044948,15882622,19609349,9140963,20444098,17121846,18160039,21097616,16497325,15699190,22431613,22171814,23834622,22431604,23859254,25356555,26929302,27381174