SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter] (ATP-binding protein), involved in resistance to linearmycin
33.95 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
resistance to linearmycin
[SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Efflux of antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    905,816 906,751

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-232) (according to UniProt)
  • Structure

  • [PDB|4YER] (from Thermotoga maritima, 39% identity)
  • [SW|Localization]

  • membrane associated (via [protein|07858BFC72EB0B6AF615C8D4C8BCC162D8C3E7D2|LnrM]-[protein|79BAF2329209C81E8D165F131F9DAADB4A81448A|LnrN]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK]: activation, [Pubmed|26647299], in [regulon|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • induced in the presence of linearmycin and other polyenes ([protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK]) [pubmed|28461449]
  • view in new tab

    Biological materials


  • MGNA-C354 (yfiL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08310 ([gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCGTCTCACTCCTTTT, downstream forward: _UP4_TTGCGGGATTGAGGAGGGAC
  • BKK08310 ([gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCGTCTCACTCCTTTT, downstream forward: _UP4_TTGCGGGATTGAGGAGGGAC
  • References

  • 10092453,26647299,27766092,28461449