SubtiBank SubtiBank
yocN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yocN

similar to permease
locus
BSU_19280
pI
3.98
mw
8.12 kDa
protein length
gene length
234 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,099,127 2,099,360

    Expression and Regulation

    Operons

    genes
    [gene|21B9A3C4FD43237062CB09B3E33F90DEE5918DD0|yozN]-[gene|332A5641DC4179CE0F780A7A9D570A2BEFB2B28D|yocN]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1B0573D639E515B2D1633805E094F9E585C90A09|yoyB]-[gene|21B9A3C4FD43237062CB09B3E33F90DEE5918DD0|yozN]-[gene|332A5641DC4179CE0F780A7A9D570A2BEFB2B28D|yocN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE19280 ([gene|332A5641DC4179CE0F780A7A9D570A2BEFB2B28D|yocN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACGGAGGGTGAAAAGAACA, downstream forward: _UP4_TAATAAGAACAGGGCGCACA
  • BKK19280 ([gene|332A5641DC4179CE0F780A7A9D570A2BEFB2B28D|yocN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACGGAGGGTGAAAAGAACA, downstream forward: _UP4_TAATAAGAACAGGGCGCACA