SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


uroporphyrinogen-III synthase
28.96 kDa
protein length
262 aa Sequence Blast
gene length
789 bp Sequence Blast
heme biosynthesis
uroporphyrinogen-III synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • Gene

    2,875,173 2,875,961

    The protein

    Catalyzed reaction/ biological activity

  • hydroxymethylbilane --> H2O + uroporphyrinogen III (according to UniProt)
  • Protein family

  • uroporphyrinogen-III synthase family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials


  • BKE28140 ([gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTTTCCTTTCAACG, downstream forward: _UP4_ATGTCAAGAGAGGAAGAGAG
  • BKK28140 ([gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTTTCCTTTCAACG, downstream forward: _UP4_ATGTCAAGAGAGGAAGAGAG
  • References


  • 28123057
  • Original Publications

  • 10217486,1672867,7628476,11532148,22960854