SubtiBank SubtiBank
yjzB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjzB

spore coat protein
locus
BSU_11320
pI
4.31
mw
8.93 kDa
protein length
gene length
240 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    1,207,818 1,208,057

    The protein

    [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|334B1821491A5F5749FC66576D09FD5233F77A3D|yjzB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE11320 ([gene|334B1821491A5F5749FC66576D09FD5233F77A3D|yjzB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCCTCCTTTCCATAT, downstream forward: _UP4_TGAAAAGCCACTTTCAAAAA
  • BKK11320 ([gene|334B1821491A5F5749FC66576D09FD5233F77A3D|yjzB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCCTCCTTTCCATAT, downstream forward: _UP4_TGAAAAGCCACTTTCAAAAA
  • References

    Reviews

  • 27227299
  • Original publications

  • 15383836,22171814,22383849