SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


methylthioribulose-1-phosphate dehydratase
23.34 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
methionine salvage
methylthioribulose-1-phosphate dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,428,940 1,429,569

    The protein

    Catalyzed reaction/ biological activity

  • 5-methylsulfanyl-D-ribulose 1-phosphate --> 5-methylsulfanyl-2,3-dioxopentyl phosphate + H2O (according to UniProt)
  • Protein family

  • aldolase class II family (with [protein|3859854178E573AE8ACCE6DF85E32C495D316DA1|AraD], according to UniProt)
  • Structure

  • [PDB|2IRP] (from Aquifex aeolicus, 40% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • view in new tab

    Biological materials


  • MGNA-B322 (ykrY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13610 ([gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTCTCTCTGCCAATTCCC, downstream forward: _UP4_GTTAAATAAAAGGAGGAATT
  • BKK13610 ([gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTCTCTCTGCCAATTCCC, downstream forward: _UP4_GTTAAATAAAAGGAGGAATT
  • References

  • 12022921,11914366,12107147,15102328,12787499,18039762,28516784