SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


58.81 kDa
protein length
516 aa Sequence Blast
gene length
1551 bp Sequence Blast
levan degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,537,507 3,539,057

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (2->6)-beta-D-fructofuranan, to remove successive disaccharide residues as levanbiose, i.e. 6-(beta-D-fructofuranosyl)-D-fructose, from the end of the chain (according to UniProt)
  • Protein family

  • glycosyl hydrolase 32 family (with [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|SacC] and [protein|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|SacA], according to UniProt)
  • Structure

  • [PDB|4FFF] (from Arthrobacter ureafaciens, 42% identity) [pubmed|22810228]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2428811], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, /antitermination via binding to a [SW|RNA switch], in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B614 (yveB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34460 ([gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGGATTCACCTTTAT, downstream forward: _UP4_TAAAAACAGGGGCGGCGCAG
  • BKK34460 ([gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGGATTCACCTTTAT, downstream forward: _UP4_TAAAAACAGGGGCGGCGCAG
  • References

  • 11739774,2428811,3039303,26773563,22810228