SubtiBank SubtiBank
levB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

levB

endolevanase
locus
BSU_34460
pI
4.99
mw
58.81 kDa
protein length
516 aa Sequence Blast
gene length
1551 bp Sequence Blast
function
levan degradation
product
endolevanase
essential
no
ec
3.2.1.64
synonyms
yveB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,537,507 3,539,057

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (2->6)-beta-D-fructofuranan, to remove successive disaccharide residues as levanbiose, i.e. 6-(beta-D-fructofuranosyl)-D-fructose, from the end of the chain (according to UniProt)
  • Protein family

  • glycosyl hydrolase 32 family (with [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|SacC] and [protein|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|SacA], according to UniProt)
  • Structure

  • [PDB|4FFF] (from Arthrobacter ureafaciens, 42% identity) [pubmed|22810228]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]-[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]
    description
    [Pubmed|11739774]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2428811], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, /antitermination via binding to a [SW|RNA switch], in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B614 (yveB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1613 NBRP B. subtilis, Japan]
  • BKE34460 ([gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGGATTCACCTTTAT, downstream forward: _UP4_TAAAAACAGGGGCGGCGCAG
  • BKK34460 ([gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGGATTCACCTTTAT, downstream forward: _UP4_TAAAAACAGGGGCGGCGCAG
  • References

  • 11739774,2428811,3039303,26773563,22810228