SubtiBank SubtiBank
mgsA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mgsA

methylglyoxal synthase
locus
BSU_22480
pI
4.92
mw
14.99 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast
function
bypass of glycolysis
product
methylglyoxal synthase
essential
no
ec
4.2.3.3
synonyms
ypjF,jojF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • Gene

    Coordinates
    2,358,911 2,359,324

    The protein

    Catalyzed reaction/ biological activity

  • dihydroxyacetone phosphate --> methylglyoxal + phosphate (according to UniProt)
  • Protein family

  • methylglyoxal synthase family (single member, according to UniProt)
  • Effectors of protein activity

  • non-phosphorylated [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh] interacts with [protein|341F198B2BD4261B20C00181D084A7C5E33E39B3|MgsA] to inhibit its activity [Pubmed|29514981,21992469]
  • Structure

  • [PDB|6F2C] [pubmed|29514981]
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A440 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/440 NBRP B. subtilis, Japan]
  • GP67 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::''tet'') [Pubmed|21992469], available in [SW|Jörg Stülke]'s lab
  • GP84 (''mgsA''::''pX2''(''cat'')), available in [SW|Jörg Stülke]'s lab
  • BKE22480 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
  • BKK22480 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
  • Expression vectors

  • pGP1301 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP1180 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP1181 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • pGP2207 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP1459]), available in [SW|Jörg Stülke]'s lab
  • pGP2505 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab [Pubmed|21992469]
  • FLAG-tag construct

  • GP86 (spc, based on [SW|pGP1331]) [Pubmed|21992469], available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Boris Görke], University of Vienna, Austria
  • [SW|Jörg Stülke], University of Göttingen, Germany, [http://genmibio.uni-goettingen.de/index.php?id=90 Homepage]
  • References

  • 10368300,21992469,20308541,22074179,23894131,28807600,29514981