SubtiBank SubtiBank
mgsA [2019-02-19 17:28:49]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mgsA [2019-02-19 17:28:49]

methylglyoxal synthase
locus
BSU22480
pI
4.92
mw
14.99 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast
function
bypass of glycolysis
product
methylglyoxal synthase
essential
no
ec
4.2.3.3
synonyms
ypjF,jojF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • Gene

    Coordinates
    2,358,911 2,359,324

    The protein

    Catalyzed reaction/ biological activity

  • Glycerone phosphate = methylglyoxal + phosphate (according to Swiss-Prot)
  • Effectors of protein activity

  • non-phosphorylated [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh] interacts with [protein|341F198B2BD4261B20C00181D084A7C5E33E39B3|MgsA] to inhibit its activity [Pubmed|29514981,21992469]
  • Structure

  • [PDB|6F2C] [pubmed|29514981]
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A440 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/440 NBRP B. subtilis, Japan]
  • GP67 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::''tet'') [Pubmed|21992469], available in [SW|Jrg Stlke]'s lab
  • GP84 (''mgsA''::''pX2''(''cat'')), available in [SW|Jrg Stlke]'s lab
  • BKE22480 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
  • BKK22480 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
  • Expression vectors

  • pGP1301 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jrg Stlke]'s lab
  • pGP1180 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jrg Stlke]'s lab
  • pGP1181 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jrg Stlke]'s lab
  • pGP2207 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP1459]), available in [SW|Jrg Stlke]'s lab
  • pGP2505 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jrg Stlke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jrg Stlke]'s lab [Pubmed|21992469]
  • FLAG-tag construct

  • GP86 (spc, based on [SW|pGP1331]) [Pubmed|21992469], available in [SW|Jrg Stlke]'s lab
  • labs

  • [SW|Boris Grke], University of Vienna, Austria
  • [SW|Jrg Stlke], University of Gttingen, Germany, [http://genmibio.uni-goettingen.de/index.php?id=90 Homepage]
  • References

  • 10368300,21992469,20308541,22074179,23894131,28807600,29514981