SubtiBank SubtiBank
mgsA [2018-03-07 17:36:14]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mgsA [2018-03-07 17:36:14]

methylglyoxal synthase
14.99 kDa
protein length
137 aa Sequence Blast
gene length
411 bp Sequence Blast
bypass of glycolysis
methylglyoxal synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • Gene

    2,358,911 → 2,359,324

    The protein

    Catalyzed reaction/ biological activity

  • Glycerone phosphate = methylglyoxal + phosphate (according to Swiss-Prot)
  • Effectors of protein activity

  • non-phosphorylated [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh] interacts with [protein|341F198B2BD4261B20C00181D084A7C5E33E39B3|MgsA] to inhibit its activity [Pubmed|21992469]
  • Structure

  • [PDB|1B93] (from ''Escherichia coli'', 50% identity, 73% similarity) [Pubmed|10368300]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials


  • MGNA-A440 ([gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::erm), available at the [ NBRP B. subtilis, Japan]
  • GP67 (Δ[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::''tet'') [Pubmed|21992469], available in [SW|Jörg Stülke]'s lab
  • GP84 (''mgsA''::''pX2''(''cat'')), available in [SW|Jörg Stülke]'s lab
  • BKE22480 (Δ[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
  • BKK22480 (Δ[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
  • Expression vector

  • pGP1301 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP1180 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP1181 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • pGP2207 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP1459]), available in [SW|Jörg Stülke]'s lab
  • pGP2505 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab [Pubmed|21992469]
  • FLAG-tag construct

  • GP86 (spc, based on [SW|pGP1331]) [Pubmed|21992469], available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Boris Görke], University of Vienna, Austria
  • [SW|Jörg Stülke], University of Göttingen, Germany, [ Homepage]
  • References

  • 10368300,21992469,20308541,22074179,23894131,28807600