SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.58 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    40,213 40,653

    The protein


  • [PDB|2QUP] (from ''Bacillus halodurans'', 40% identity)
  • Expression and Regulation


    view in new tab



  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B898 (yaaR::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1713 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE00300 (''[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE00300 ([gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTTCAGATCCTTAAA, downstream forward: _UP4_CTTTACACATAGAGAGTGAT
  • BKK00300 ([gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTTCAGATCCTTAAA, downstream forward: _UP4_CTTTACACATAGAGAGTGAT
  • Expression vectors

  • pGP2673: expression of ''yaaR''-Strep by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22383849