SubtiBank SubtiBank
yhdA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdA

NADPH-dependent FMN oxidoreductase
locus
BSU_09340
pI
6.51
mw
18.76 kDa
protein length
174 aa Sequence Blast
gene length
525 bp Sequence Blast
function
protection against oxidative stress
product
NADPH-dependent FMN oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,010,445 1,010,969

    The protein

    Protein family

  • azoreductase type 2 family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|CAFAE305B1771DD89E81F75A6713161393BE99A0|PgcM]:
  • [SW|Cofactors]

  • FMN [Pubmed|16752898]
  • NADPH [pubmed|32801174]
  • Structure

  • [PDB|3GFQ] (99% identity),
  • [PDB|1NNI]
  • Expression and Regulation

    Operons

    genes
    [gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]-[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]-[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]
    description
    [Pubmed|16816187]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16816187], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A689 (yhdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/689 NBRP B. subtilis, Japan]
  • BKE09340 ([gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGCCATTTATGACTAACA, downstream forward: _UP4_GGCGTCTAAACGCCGGGATT
  • BKK09340 ([gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGCCATTTATGACTAACA, downstream forward: _UP4_GGCGTCTAAACGCCGGGATT
  • References

  • 16816187,16752898,20639339,20640807,32801174