SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to macrolide 2-phosphotransferase
34.33 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    275,838 276,758

    The protein

    Protein family

  • aminoglycoside phosphotransferase family (with [protein|651F41AA16B0BB59A613D74302F441BF6D5BFF64|YtmP], according to UniProt)
  • Structure

  • [PDB|5IGV] (from E. coli, 43% identity) [pubmed|28416110]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials


  • MGNA-C032 (ycbJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02520 ([gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATTTCCCCTTTCTC, downstream forward: _UP4_TAAGAATTGACTTCGTTTCA
  • BKK02520 ([gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATTTCCCCTTTCTC, downstream forward: _UP4_TAAGAATTGACTTCGTTTCA
  • References

  • 12044674,18840696,28416110