SubtiBank SubtiBank
ycbJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycbJ

similar to macrolide 2-phosphotransferase
locus
BSU_02520
pI
4.57
mw
34.33 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    275,838 276,758

    The protein

    Protein family

  • aminoglycoside phosphotransferase family (with [protein|651F41AA16B0BB59A613D74302F441BF6D5BFF64|YtmP], according to UniProt)
  • Structure

  • [PDB|5IGV] (from E. coli, 43% identity) [pubmed|28416110]
  • Expression and Regulation

    Operons

    genes
    [gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
    description
    [Pubmed|12044674]

    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C032 (ycbJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2030 NBRP B. subtilis, Japan]
  • BKE02520 ([gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATTTCCCCTTTCTC, downstream forward: _UP4_TAAGAATTGACTTCGTTTCA
  • BKK02520 ([gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATTTCCCCTTTCTC, downstream forward: _UP4_TAAGAATTGACTTCGTTTCA
  • References

  • 12044674,18840696,28416110