SubtiBank SubtiBank
ykvU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykvU

spore cortex membrane protein, required for germination at high pressure
locus
BSU13830
pI
9.55
mw
49.24 kDa
protein length
445 aa Sequence Blast
gene length
1335 bp Sequence Blast
function
germination at high pressure
product
spore cortex membrane protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,449,250 → 1,450,587

    The protein

    Protein family

  • [SW|MOP exporter family]
  • Paralogous protein(s)

  • [protein|9633C40190B7D0EA264270FD44567C61A012AD15|SpoVB], [protein|D6B1837075ECBEE1FEAC704DDB6795336092897F|YabM], [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|MurJ]
  • [SW|Localization]

  • forespore membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]-[gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]
    description
    [Pubmed|15292147]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15292147], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A055 (ykvU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/55 NBRP B. subtilis, Japan]
  • 1S131 ( ''ykvU''::''tet''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S131&Search=1S131 BGSC]
  • BKE13830 (Δ[gene|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCTCTCCTTGTCT, downstream forward: _UP4_TGATAAAGGAACAGCAGGGG
  • BKK13830 (Δ[gene|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCTCTCCTTGTCT, downstream forward: _UP4_TGATAAAGGAACAGCAGGGG
  • References

  • 15686839,19648239,19666716,15292147,12662922