SubtiBank SubtiBank
guaC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

guaC

GMP reductase
locus
BSU_32130
pI
6.08
mw
35.66 kDa
protein length
326 aa Sequence Blast
gene length
981 bp Sequence Blast
function
purine salvage and interconversion
product
GMP reductase
essential
no
ec
1.7.1.7
synonyms
yumD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • Gene

    Coordinates
    3,303,042 3,304,022

    The protein

    Catalyzed reaction/ biological activity

  • Inosine 5'-phosphate + NH3 + NADP+ --> guanosine 5'-phosphate + NADPH (according to UniProt)
  • Protein family

  • IMPDH/GMPR family (together with [protein|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|GuaB]) (according to UniProt)
  • Structure

  • [PDB|1YPF] (from ''Bacillus anthracis'', 84% identity, 91% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|guaC]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 3 to 20 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B573 (yumD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1572 NBRP B. subtilis, Japan]
  • BKE32130 ([gene|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|guaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTTCACTCCTAAAA, downstream forward: _UP4_TAATCATAAAAAAACGCCAA
  • BKK32130 ([gene|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|guaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTTCACTCCTAAAA, downstream forward: _UP4_TAATCATAAAAAAACGCCAA
  • References

  • 11591660,2536750,12618455,12850135,21815947