SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


5-dehydro-4-deoxyglucarate dehydratase
33.89 kDa
protein length
308 aa Sequence Blast
gene length
927 bp Sequence Blast
utilization of D-glucarate/galactarate
5-dehydro-4-deoxyglucarate dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucarate/galactarate]
  • Gene

    267,890 268,816

    The protein

    Catalyzed reaction/ biological activity

  • 5-dehydro-4-deoxy-D-glucarate + H+ --> 2,5-dioxopentanoate + CO2 + H2O (according to UniProt)
  • Protein family

  • DapA family (with [protein|00B4CA4E25858A56F9D4E0ADEE2643F203FEC613|DapA], according to UniProt)
  • Structure

  • [PDB|4UR8] (from Agrobacterium fabrum, 38% identity) [pubmed|25454257]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials


  • MGNA-C027 (ycbC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02460 ([gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAACATAACCTCCTGTT, downstream forward: _UP4_TGACCAGAAAAAACACGAAA
  • BKK02460 ([gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAACATAACCTCCTGTT, downstream forward: _UP4_TGACCAGAAAAAACACGAAA
  • References

  • 12044674,25454257