SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


beta-glucoside permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBCA of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|search|LicT ]activity
64.52 kDa
protein length
609 aa Sequence Blast
gene length
1830 bp Sequence Blast
beta-glucoside uptake and phosphorylation, control of [protein|search|LicT ]activity
beta-glucoside permease of the [SW|phosphotransferase systems|phosphotransferase system]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of beta-glucosides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    4,033,778 4,035,607

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|531F132F7F6A878F1E1D56977B9898A14272349A|SacX], [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP], [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|TreP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|MurP]
  • [SW|Domains]

  • [SW|PTS EIIA domain] type-1 (aa 480-584) (according to UniProt)
  • [SW|PTS EIIB domain] type-1 (aa 1-86) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 103-459) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|23475962]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7559347], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] binding site overlaps -35 region) [Pubmed|7559347], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]: anti-termination, via [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent [SW|RNA switch], lack of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent antitermination in the presence of gucose due to the requirement of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT] to be phosphorylated by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK], in [regulon|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT regulon]
  • regulation

  • induced by salicin ([protein|search|LicT]) [Pubmed|7883710]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|bglP]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • GP475 (erm), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
  • BKE39270 ([gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATACCTCCTTTTT, downstream forward: _UP4_TGAAAAAACTAATGGGGTGA
  • BKK39270 ([gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATACCTCCTTTTT, downstream forward: _UP4_TGAAAAAACTAATGGGGTGA
  • Expression vectors

  • pGP1290 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab,
  • pGP1300 (expression of ''[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]'' in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP600 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1266, [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
  • References

  • 16672620,20525796,10627040,7883710,8626332,7559347,22900538,23475962