SubtiBank SubtiBank
comEC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comEC

channel protein for DNA binding and uptake
locus
BSU_25570
pI
6.96
mw
86.51 kDa
protein length
776 aa Sequence Blast
gene length
2331 bp Sequence Blast
function
genetic competence
product
DNA channel
essential
no
synonyms
comD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,637,543 2,639,873

    The protein

    [SW|Localization]

  • cell membrane [Pubmed|15661011]
  • localizes to one or both cell poles [Pubmed|21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
    description
    [Pubmed|7968523,19028902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7968523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Other regulations

  • [protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|ComN]: post-translation control,
  • Biological materials

    Mutant

  • GP2643 ([gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE25570 ([gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATCACACGTAGCTCG, downstream forward: _UP4_TAAAAAAGACTGCCGAGAAA
  • BKK25570 ([gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATCACACGTAGCTCG, downstream forward: _UP4_TAAAAAAGACTGCCGAGAAA
  • References

    Reviews

  • 15083159
  • Original publications

  • 17630974,11814663,15661011,7968523,21278288,19028902,27318187