SubtiBank SubtiBank
galK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

galK

galactokinase
locus
BSU_38200
pI
5.15
mw
43.36 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
function
galactose utilization
product
galactokinase
essential
no
ec
2.7.1.6
synonyms
ipa-35d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.8|Utilization of galactose]
  • Gene

    Coordinates
    3,920,638 3,921,810

    The protein

    Catalyzed reaction/ biological activity

  • α-D-galactose + ATP --> ADP + α-D-galactose 1-phosphate + H+ (according to UniProt)
  • Protein family

  • GHMP kinase family (together with [protein|8FA635D1915108BF29A864AF4DA28ECF633F735F|IspE] and [protein|290302BA8A4E44C62AE3071C1F7DE18B20605607|ThrB]) (according to UniProt)
  • Structure

  • [PDB|1PIE] (from ''Lactococcus lactis'', 43% identity, 60% similarity) [Pubmed|12796487]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]-[gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    genes
    [gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]-[gene|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|gtcA]-[gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]-[gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]
    description
    [Pubmed|22383849,22893383]

    regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • BKE38200 ([gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCAATCACCTTTCTG, downstream forward: _UP4_AGAGAACTAAAGGGGGAGTG
  • BKK38200 ([gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCAATCACCTTTCTG, downstream forward: _UP4_AGAGAACTAAAGGGGGAGTG
  • References

  • 9353933,10666464,22383849,22893383