SubtiBank SubtiBank
yfmP
The papers of the month are back! Check them out! Link here

yfmP

transcription repressor ([SW|MerR family]) of the [gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]-[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO] operon
locus
BSU07390
pI
5.23
mw
16.36 kDa
protein length
140 aa Sequence Blast
gene length
420 bp Sequence Blast
function
regulation of the [gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]-[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO] operon
product
transcription repressor ([SW|MerR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    812,140 → 812,562

    The protein

    Protein family

  • [SW|MerR family]
  • Structure

  • [PDB|3QAO] (from Listeria monocytogenes, 29% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]-[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO]
    description
    [Pubmed|14663075]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14663075], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|YfmP]: repression, [Pubmed|14663075], in [regulon|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|YfmP regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C236 (yfmP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2234 NBRP B. subtilis, Japan]
  • BKE07390 (Δ[gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGTAAATCCCCCTTCGC, downstream forward: _UP4_TGAAAAGTTTGTTAAACGCT
  • BKK07390 (Δ[gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGTAAATCCCCCTTCGC, downstream forward: _UP4_TGAAAAGTTTGTTAAACGCT
  • References

  • 14663075