SubtiBank SubtiBank
ycbF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycbF

glucarate dehydratase
locus
BSU_02490
pI
5.59
mw
50.62 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
function
glucarate utilization
product
glucarate dehydratase
essential
no
ec
4.2.1.40
synonyms
gudD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.14|Utilization of glucarate/galactarate]
  • Gene

    Coordinates
    271,800 273,167

    The protein

    Catalyzed reaction/ biological activity

  • D-glucarate --> 5-dehydro-4-deoxy-D-glucarate + H2O (according to UniProt)
  • Protein family

  • [SW|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
  • Structure

  • [PDB|1EC7] (from E. coli, 73% identity) [pubmed|10769114]
  • Expression and Regulation

    Operons

    genes
    [gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
    description
    [Pubmed|12044674]

    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C029 (ycbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2027 NBRP B. subtilis, Japan]
  • BKE02490 ([gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCATTTTCCTCCCTTTA, downstream forward: _UP4_TAAGTTTGATTGTAAATATT
  • BKK02490 ([gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCATTTTCCTCCCTTTA, downstream forward: _UP4_TAAGTTTGATTGTAAATATT
  • References

  • 12044674,10769114