SubtiBank SubtiBank
ycdA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycdA

lipoprotein, required for swarming motility
locus
BSU_02780
pI
4.71
mw
39.02 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
swarming motility
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.4|Motility and chemotaxis/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    299,438 300,502

    Phenotypes of a mutant

  • reduced swarming motility [Pubmed|22496484]
  • The protein

    [SW|Domains]

  • [SW|DUF4352] (aa 39 ... 148) (according to UniProt)
  • DUF5105 (aa 164 ... 352) (according to UniProt)
  • Structure

  • [PDB|4R4G]
  • [SW|Localization]

  • lipoprotein [Pubmed|22496484]
  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]
    description
    [Pubmed|22496484]

    regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|22496484], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|SwrAA/2]: activation, in [regulon|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|SwrAA/2 regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''ycdA'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B978 (ycdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1977 NBRP B. subtilis, Japan]
  • BKE02780 ([gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTCCTCCTCAA, downstream forward: _UP4_TAAAACACCAAAAGGAAATA
  • BKK02780 ([gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTCCTCCTCAA, downstream forward: _UP4_TAAAACACCAAAAGGAAATA
  • References

  • 18763711,20817675,20525796,22496484,27120414