SubtiBank SubtiBank
ycdA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycdA

lipoprotein, required for swarming motility
locus
BSU_02780
pI
4.71
mw
39.02 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
swarming motility
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.4|Motility and chemotaxis/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    299,438 300,502

    Phenotypes of a mutant

  • reduced swarming motility [Pubmed|22496484]
  • The protein

    [SW|Domains]

  • [SW|DUF4352] (aa 39 ... 148) (according to UniProt)
  • DUF5105 (aa 164 ... 352) (according to UniProt)
  • Structure

  • [PDB|4R4G]
  • [SW|Localization]

  • lipoprotein [Pubmed|22496484]
  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]
    description
    [Pubmed|22496484]

    regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|22496484], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|SwrAA/2]: activation, in [regulon|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|SwrAA/2 regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''ycdA'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B978 (ycdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1977 NBRP B. subtilis, Japan]
  • BKE02780 ([gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTCCTCCTCAA, downstream forward: _UP4_TAAAACACCAAAAGGAAATA
  • BKK02780 ([gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTCCTCCTCAA, downstream forward: _UP4_TAAAACACCAAAAGGAAATA
  • References

  • 18763711,20817675,20525796,22496484,27120414