SubtiBank SubtiBank


required for dehydratation of the spore core and assembly of the coat, mutation increases [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression, might act via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]
8.66 kDa
protein length
gene length
261 bp Sequence Blast
spore coat assembly, spore core dehydratation

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    1,769,935 1,770,195

    Phenotypes of a mutant

  • increased [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression, this might occur via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|16428420]
  • The protein


  • [PDB|2EK0] (from ''Thermus thermophilus'', 56% identity)
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|7559352], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • expressed at the onset of stationary phase ([protein|search|SigH]) [Pubmed|7559352]
  • view in new tab

    Biological materials


  • GP1601 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::cat), available in [SW|Jörg Stülke]'s lab
  • GP1848 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [SW|Jörg Stülke]'s lab
  • BKE16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT, downstream forward: _UP4_TAAAAACAAATAAAGCATTC
  • BKK16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT, downstream forward: _UP4_TAAAAACAAATAAAGCATTC
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 7559352,18562273,16428420,20525796