SubtiBank SubtiBank
glcD

glcD

probably glycolate oxidase subunit, FAD-binding
locus
BSU_28680
pI
4.86
mw
50.77 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
unknown
product
probably glycolate oxidase subunit
essential
no
ec
1.1.3.15
synonyms
ysfC, glcD

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,933,185 2,934,597

    The protein

    Protein family

  • FAD-binding oxidoreductase/transferase type 4 family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|FAD-binding PCMH-type domain] (aa 37-216) (according to UniProt)
  • [SW|Cofactors]

  • FAD (acording to UniProt)
  • Structure

  • [PDB|3PM9] (dehydrogenase from Rhodopseudomonas palustris, 32% identity)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of (S)-2-hydroxy-acid oxidase EC 1.1.3.15. No EC annotation is available in Swiss-Prot. In MetaCyc, it is annotated as similar to glycolate oxidase subunit. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]-[gene|DDD01D9C50BC11A50D263946ECA15CB58570ACAA|glcF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B001 (ysfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1000 NBRP B. subtilis, Japan]
  • BKE28680 ([gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCCATCCCCCTGT, downstream forward: _UP4_AGAAAACGTGTGGTGGCGGA
  • BKK28680 ([gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCCATCCCCCTGT, downstream forward: _UP4_AGAAAACGTGTGGTGGCGGA
  • References

    Research papers

  • 27264531,8606183