SubtiBank SubtiBank
ydeN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeN

unknown
locus
BSU_05260
pI
6.20
mw
21.58 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    573,452 574,024

    The protein

    Protein family

  • RBBP9 family (single member, according to UniProt)
  • Structure

  • [PDB|1UXO]
  • Expression and Regulation

    Operons

    genes
    [gene|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|ydzF]-[gene|3874C566F1C71F985C86726458B8544F115A6396|ydeN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C136 (ydeN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2134 NBRP B. subtilis, Japan]
  • BKE05260 ([gene|3874C566F1C71F985C86726458B8544F115A6396|ydeN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCCTCCTAAGAAA, downstream forward: _UP4_TAACATCTTTCACCCATCTG
  • BKK05260 ([gene|3874C566F1C71F985C86726458B8544F115A6396|ydeN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCCTCCTAAGAAA, downstream forward: _UP4_TAACATCTTTCACCCATCTG