SubtiBank SubtiBank
glpP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glpP

transcriptional antiterminator of the glpT-glpQ and glpF-glpK-glpD operons
locus
BSU_09270
pI
8.10
mw
21.46 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
function
regulation of glycerol and glycerol-3-phosphate utilization
product
transcriptional antiterminator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    Coordinates
    1,001,744 1,002,322

    The protein

    Structure

  • [PDB|3KTS] (from Listeria monocytogenes, 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]-[gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]
    description
    [Pubmed|2127799]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21925382], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • view in new tab

    Biological materials

    Mutant

  • BKE09270 ([gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCTCCTTTAATAATT, downstream forward: _UP4_TGACACCGCTTTCATGCACT
  • BKK09270 ([gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCTCCTTTAATAATT, downstream forward: _UP4_TGACACCGCTTTCATGCACT
  • labs

  • [SW|Josef Deutscher], Paris-Grignon, France
  • References

  • 8825777,11929549,8436953,9595668,9493382,1479885,1809833,182672,21925382