SubtiBank SubtiBank
lnrK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lnrK

two-component response regulator, involved in resistance to linearmycin
locus
BSU_08300
pI
4.67
mw
24.22 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
resistance to linearmycin
product
two-component response regulator
essential
no
synonyms
yfiK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    905,010 905,672

    The protein

    Paralogous protein(s)

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ], [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI], [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL]
  • Modification

  • phosphorylated by [protein|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|LnrJ] on an Asp residue
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 42% identity) [pubmed|27670715]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]-[gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]
    description
    [Pubmed|8973323]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C301 (yfiK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2299 NBRP B. subtilis, Japan]
  • BKE08300 ([gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTCGGTAATGATGATCT, downstream forward: _UP4_TGACATATGACGTTTTGCAT
  • BKK08300 ([gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTCGGTAATGATGATCT, downstream forward: _UP4_TGACATATGACGTTTTGCAT
  • References

  • 10094672,8973323,26647299,28461449,27670715