SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


adenine phosphoribosyltransferase, universally conserved protein
18.73 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
purine salvage and interconversion
adenine phosphoribosyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    2,822,901 2,823,413

    The protein

    Catalyzed reaction/ biological activity

  • AMP + diphosphate --> 5-phospho-α-D-ribose 1-diphosphate + adenine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-85 [Pubmed|22517742]
  • Structure

  • [PDB|2DY0] (from ''Escherichia coli k12'', 56% identity, 66% similarity)
  • Additional information

  • [SW|universally conserved protein]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • BKE27610 ([gene|38DF74800FC5D54183C58B0EB82BD9A3EB93EE33|apt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATTGTTTTAAATCCATCT, downstream forward: _UP4_TAAGGATAACCGCATAACGA
  • BKK27610 ([gene|38DF74800FC5D54183C58B0EB82BD9A3EB93EE33|apt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATTGTTTTAAATCCATCT, downstream forward: _UP4_TAAGGATAACCGCATAACGA
  • References

  • 3110131,15241682,22517742