SubtiBank SubtiBank
spoVD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spoVD

mother-cell specific penicillin-binding protein (spore cortex)
locus
BSU_15170
pI
8.85
mw
71.08 kDa
protein length
646 aa Sequence Blast
gene length
1941 bp Sequence Blast
function
spore morphogenesis
product
penicillin-binding protein (spore cortex)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.7|Penicillin-binding proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,584,214 1,586,154

    The protein

    Catalyzed reaction/ biological activity

  • protects [protein|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|SpoVE] from proteolytic degradation [Pubmed|20417640]
  • Protein family

  • [SW|transpeptidase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EBEFF9E0A524DCDA19382E5401B923B805E4C559|PbpB]
  • [SW|Domains]

  • C-terminal [SW|PASTA domain] (aa 580-638) [Pubmed|25481876]
  • Effectors of protein activity

  • intramolecular disulfide bonds between two Cys residues are reduced by [protein|0B299F9459023306FA91298A6162A09E4A87C3B2|StoA], this is rquired for activity of SpoVD [Pubmed|19919673]
  • Structure

  • [PDB|1PYY] (PBP2B from Spreptococcus pneumoniae, 26% identity) [pubmed|12923202]
  • [SW|Localization]

  • intermembrane space that separates forespores from mother cells [Pubmed|19919673]
  • Expression and Regulation

    Operons

    genes
    [gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]
    description
    [Pubmed|8436954]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,15758244], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|9006059], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,15758244]
  • view in new tab

    Biological materials

    Mutant

  • 1A975 ( ''spoVD''::''cat''), [Pubmed|19212404], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A975&Search=1A975 BGSC]
  • BKE15170 ([gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGACCGTTCACTCCTT, downstream forward: _UP4_TGATTCGGGCTGCCTATTCT
  • BKK15170 ([gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGACCGTTCACTCCTT, downstream forward: _UP4_TGATTCGGGCTGCCTATTCT
  • References

    Reviews

  • 19919674
  • Original Publications

  • 9006059,8289242,15699190,15758244,8436954,9006059,19919673,20417640,23789716,25481876,28383125,29661861,12923202