SubtiBank SubtiBank
ylmB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ylmB

N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase, thiamine salvage pathway
locus
BSU_15350
pI
4.98
mw
47.02 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
thiamine salvage
product
N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,607,556 1,608,836

    The protein

    Catalyzed reaction/ biological activity

  • H2O + N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine --> 4-amino-5-aminomethyl-2-methylpyrimidine + formate (according to UniProt)
  • Protein family

  • [SW|peptidase M20A family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|161ADC907D4902001C8751F51CFA762828C26110|YodQ]
  • [SW|Cofactors]

  • Binds 2 zinc or cobalt ions per subunit (according to Swiss-Prot)
  • Structure

  • [PDB|3PFO] (from Rhodopseudomonas palustris, 25% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: RNA switch, antitermination via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation:

  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B124 (ylmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1123 NBRP B. subtilis, Japan]
  • BKE15350 ([gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTAAATCCGCTCCTAT, downstream forward: _UP4_TGACATGAAAATTTCTTCTT
  • BKK15350 ([gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTAAATCCGCTCCTAT, downstream forward: _UP4_TGACATGAAAATTTCTTCTT
  • References

  • 17618314,12376536,28516784,29794222