SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


12.85 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,444,645 2,444,998

    The protein

    Protein family

  • anti-sigma-factor antagonist family (with [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV], according to UniProt)
  • [SW|Domains]

  • [SW|STAS domain] (aa 3-113) (according to UniProt)
  • Modification

  • phosphorylation on (Ser-58 OR Ser-59) by [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB][Pubmed|17218307], [Pubmed|16493705]
  • Structure

  • [PDB|1TIL] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], Geobacillus stearothermophilus) [pubmed|15236958]
  • [PDB|1AUZ] (NMR)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|1556084,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • strongly repressed in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT, downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
  • BKK23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT, downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
  • labs

  • [SW|Tony Wilkinson], York University, U.K. [ homepage]
  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 31350897
  • Modeling of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation

  • 24067622,22312331,20298743
  • Original Publications

  • 1391042,8358793,8955289,15023063,15351644,9077448,10323866,8820658,8622920,16824103,7570023,10476035,8932322,8764398,8764397,12676949,9826498,9826499,14744853,9642177,11684022,8846916,11298272,1948031,3114419,11846550,15201047,2123551,8168129,1556084,15687200,12850135,16493705,17218307,10049355,20817675,11846550,15236958