SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


12.85 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,444,645 2,444,998

    The protein

    Protein family

  • anti-sigma-factor antagonist family (with [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV], according to UniProt)
  • [SW|Domains]

  • [SW|STAS domain] (aa 3-113) (according to UniProt)
  • Modification

  • phosphorylation on (Ser-58 OR Ser-59) by [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB][Pubmed|17218307], [Pubmed|16493705]
  • Structure

  • [PDB|1TIL] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], Geobacillus stearothermophilus) [pubmed|15236958]
  • [PDB|1AUZ] (NMR)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|1556084,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • strongly repressed in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT, downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
  • BKK23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT, downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
  • labs

  • [SW|Tony Wilkinson], York University, U.K. [ homepage]
  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 31350897
  • Modeling of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation

  • 24067622,22312331,20298743
  • Original Publications

  • 1391042,8358793,8955289,15023063,15351644,9077448,10323866,8820658,8622920,16824103,7570023,10476035,8932322,8764398,8764397,12676949,9826498,9826499,14744853,9642177,11684022,8846916,11298272,1948031,3114419,11846550,15201047,2123551,8168129,1556084,15687200,12850135,16493705,17218307,10049355,20817675,11846550,15236958