SubtiBank SubtiBank
yobV
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yobV

unknown
locus
BSU_19100
pI
5.94
mw
36.38 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,083,067 2,084,008

    The protein

    [SW|Domains]

  • [SW|HTH deoR-type domain] (aa 2-57) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|397FD56AE92A20979B0581CF1D75B5CD6F5436E2|yobV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A318 (yobV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/318 NBRP B. subtilis, Japan]
  • BKE19100 ([gene|397FD56AE92A20979B0581CF1D75B5CD6F5436E2|yobV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCGCACCTTTTCTT, downstream forward: _UP4_TGACACACTGCTGTCAGGTT
  • BKK19100 ([gene|397FD56AE92A20979B0581CF1D75B5CD6F5436E2|yobV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCGCACCTTTTCTT, downstream forward: _UP4_TGACACACTGCTGTCAGGTT