SubtiBank SubtiBank


elemental iron uptake system, heme peroxidase, converts ferrous iron (Fe(II) to ferric iron (FeIII)) for uptake by [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO]-[protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU], peroxide detoxification under microaerobic conditions
45.53 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
ferrous iron conversion
heme peroxidase in elemental iron uptake

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Elemental iron transport system]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Elemental iron transport system]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,926,682 3,927,932

    The protein

    Catalyzed reaction/ biological activity

  • oxidizes ferrous iron to ferric iron for uptake by [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO]-[protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] [Pubmed|23764491]
  • eliminates reactive oxygen species that accumulate in the presence of ferrous iron [Pubmed|23764491]
  • peroxide detoxification under microaerobic conditions [Pubmed|23764491]
  • Protein family

  • DyP-type peroxidase family (single member, according to UniProt)
  • [SW|Cofactors]

  • protoheme IX [Pubmed|23764491]
  • Effectors of protein activity

  • activity is increased in the presence of [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO] due to the displacement of ferric iron [Pubmed|23764491]
  • Structure

  • [PDB|2Y4F] (from ''E. coli'', 38% identity)
  • [SW|Localization]

  • extracellular, secreted by the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] complex [Pubmed|15554971]
  • [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]-dependent export of [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] requires a functional [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] [Pubmed|23180473]
  • forms a membrane-bound complex with [protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] and [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO] for iron uptake [Pubmed|23180473,23764491]
  • attached to the membrane via [protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] [Pubmed|23764491]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23764491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials


  • MGNA-B228 (ywbN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38260 ([gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
  • BKK38260 ([gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References


  • 24140208
  • Original publications

  • 16672620,19180538,12354229,19383693,9353933,9683469,15554971,21479178,18179421,22923395,23180473,23560556,23764491,23820555,24620988,18931290,26239117,27795321,29133393