SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


elemental iron uptake system, heme peroxidase, converts ferrous iron (Fe(II) to ferric iron (FeIII)) for uptake by [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO]-[protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU], peroxide detoxification under microaerobic conditions
45.53 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
ferrous iron conversion
heme peroxidase in elemental iron uptake

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Elemental iron transport system]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Elemental iron transport system]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,926,682 3,927,932

    The protein

    Catalyzed reaction/ biological activity

  • oxidizes ferrous iron to ferric iron for uptake by [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO]-[protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] [Pubmed|23764491]
  • eliminates reactive oxygen species that accumulate in the presence of ferrous iron [Pubmed|23764491]
  • peroxide detoxification under microaerobic conditions [Pubmed|23764491]
  • Protein family

  • DyP-type peroxidase family (single member, according to UniProt)
  • [SW|Cofactors]

  • protoheme IX [Pubmed|23764491]
  • Effectors of protein activity

  • activity is increased in the presence of [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO] due to the displacement of ferric iron [Pubmed|23764491]
  • Structure

  • [PDB|2Y4F] (from ''E. coli'', 38% identity)
  • [SW|Localization]

  • extracellular, secreted by the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] complex [Pubmed|15554971]
  • [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]-dependent export of [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] requires a functional [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] [Pubmed|23180473]
  • forms a membrane-bound complex with [protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] and [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO] for iron uptake [Pubmed|23180473,23764491]
  • attached to the membrane via [protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] [Pubmed|23764491]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23764491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials


  • MGNA-B228 (ywbN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38260 ([gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
  • BKK38260 ([gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References


  • 24140208
  • Original publications

  • 16672620,19180538,12354229,19383693,9353933,9683469,15554971,21479178,18179421,22923395,23180473,23560556,23764491,23820555,24620988,18931290,26239117,27795321,29133393