SubtiBank SubtiBank
yqxD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxD

unknown
locus
BSU_25230
pI
7.17
mw
22.40 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqfM

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,603,373 2,603,867

    The protein

    Protein family

  • UPF0178 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|398924959D6C82918617C4B050F72D5E78EE12E9|yqxD]-[gene|F7B53E8AC92DAD15544C6208C2A5B41BABA73D6D|dnaG]-[gene|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]
    description
    [Pubmed|3298998]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3298998], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|3127379], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • enzymatic activity is inhibited by (p)ppGpp during the 'stringent response
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C491 (yqxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2489 NBRP B. subtilis, Japan]
  • BKE25230 ([gene|398924959D6C82918617C4B050F72D5E78EE12E9|yqxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAACTCCTGCATAAAA, downstream forward: _UP4_TAAAGCATCGAATAATGTAC
  • BKK25230 ([gene|398924959D6C82918617C4B050F72D5E78EE12E9|yqxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAACTCCTGCATAAAA, downstream forward: _UP4_TAAAGCATCGAATAATGTAC
  • References

  • 3298998,10411753,3127379