SubtiBank SubtiBank
ahpT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ahpT

thiol disulfide oxidoreductase, reduces [protein|B283B702D917E310130BC33A40BF6A5853C3D4C1|AhpA]
locus
BSU_14230
pI
6.33
mw
17.66 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
protection of proteins against oxidative damage
product
thiol disulfide oxidoreductase
essential
no
synonyms
ykuV

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,492,875 1,493,321

    The protein

    [SW|Domains]

  • [SW|Thioredoxin domain] (aa 2-145) (according to UniProt)
  • Structure

  • [PDB|2B5X] (reduced form), [PDB|2B5Y] (oxidized form)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]-[gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP1729 [gene|search|ahpAT]::kan trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-B344 (ykuV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1343 NBRP B. subtilis, Japan]
  • BKE14230 ([gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCCTCCTAT, downstream forward: _UP4_TAGGTATCTGACTAAATAGT
  • BKK14230 ([gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCCTCCTAT, downstream forward: _UP4_TAGGTATCTGACTAAATAGT
  • References

  • 20817675,16418167,26787766