SubtiBank SubtiBank
yheD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yheD

ATP-binding spore coat protein
locus
BSU_09770
pI
8.74
mw
51.20 kDa
protein length
453 aa Sequence Blast
gene length
1362 bp Sequence Blast
function
protection of the spore
product
ATP-binding spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.2|Class II]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,050,811 1,052,172

    The protein

    Protein family

  • YheC/YheD family (with [protein|01419E9D0CB49D8683A6C3D3CD0074D5A150487C|YheC], according to UniProt)
  • Paralogous protein(s)

  • [protein|01419E9D0CB49D8683A6C3D3CD0074D5A150487C|YheC]
  • [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|01419E9D0CB49D8683A6C3D3CD0074D5A150487C|yheC]-[gene|39D64F294CDF64A3F5334CDEDEA642E519C89B6F|yheD]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|26577401,15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,15383836,12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B493 (yheD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1492 NBRP B. subtilis, Japan]
  • BKE09770 ([gene|39D64F294CDF64A3F5334CDEDEA642E519C89B6F|yheD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAGGATTCACGCGGAAG, downstream forward: _UP4_TAACCTGTCCGCTTTTTTAA
  • BKK09770 ([gene|39D64F294CDF64A3F5334CDEDEA642E519C89B6F|yheD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAGGATTCACGCGGAAG, downstream forward: _UP4_TAACCTGTCCGCTTTTTTAA
  • References

    Reviews

  • 23202530,27227299
  • Original publications

  • 15231775,12480901,15383836,22171814,26577401