SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


general stress protein, survival of ethanol and paraquat stresses
22.39 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
survival of stress conditions

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    624,492 625,109

    The protein


  • [PDB|4MDW]
  • [PDB|2KY9]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,10482513]
  • view in new tab

    Biological materials


  • MGNA-C186 (ydhK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05790 ([gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAACATGCCCTCTC, downstream forward: _UP4_GCTAAATAATAAAAAATCCT
  • BKK05790 ([gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAACATGCCCTCTC, downstream forward: _UP4_GCTAAATAATAAAAAATCCT
  • References

  • 15805528,10482513,22582280