SubtiBank SubtiBank
yoeA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yoeA

probable multidrug resistance protein
locus
BSU_18370
pI
10.00
mw
51.12 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
unknown
product
putative multidrug exporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.15|Multidrug exporters/ based on homology]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,000,960 2,002,351

    The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
  • Structure

  • [PDB|3VVO] (MATE multidrug exporter from Pyrococcus furiosus, 25% identity) [pubmed|23535598]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3A45214C724902530D9808D41EDA20AFF71D1D59|yoeA]
    description
    [Pubmed|22383849]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|yoeA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE18370 ([gene|3A45214C724902530D9808D41EDA20AFF71D1D59|yoeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAAAGGACTCCTTTA, downstream forward: _UP4_TAGCCTCCGAATCACACCGT
  • BKK18370 ([gene|3A45214C724902530D9808D41EDA20AFF71D1D59|yoeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAAAGGACTCCTTTA, downstream forward: _UP4_TAGCCTCCGAATCACACCGT
  • References

  • 20525796,22383849,23535598