SubtiBank SubtiBank
ycxD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycxD

similar to transcriptional regulator ([SW|MocR/ GabR family])
locus
BSU_03560
pI
8.57
mw
50.59 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    406,131 407,465

    The protein

    Protein family

  • [SW|MocR/ GabR family] [Pubmed|22020104]
  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Domains]

  • N-terminal DNA-binding helix-turn-helix motif; C-terminal domain is homologous to PLP-binding large domain of aminotransferases.
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|4MGR] ([protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR], 27% identity) [pubmed|24127574]
  • Biological materials

    Mutant

  • BKE03560 ([gene|3A756A845ADA88DA569FA9A1B484DA43A28C6F4D|ycxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTCTCCCCCTGTTT, downstream forward: _UP4_GGTGTCAAGCTGTTGATGAG
  • BKK03560 ([gene|3A756A845ADA88DA569FA9A1B484DA43A28C6F4D|ycxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTCTCCCCCTGTTT, downstream forward: _UP4_GGTGTCAAGCTGTTGATGAG
  • References

  • 11756427,22020104,24127574