SubtiBank SubtiBank
ycxD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycxD

similar to transcriptional regulator ([SW|MocR/ GabR family])
locus
BSU_03560
pI
8.57
mw
50.59 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    406,131 407,465

    The protein

    Protein family

  • [SW|MocR/ GabR family] [Pubmed|22020104]
  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Domains]

  • N-terminal DNA-binding helix-turn-helix motif; C-terminal domain is homologous to PLP-binding large domain of aminotransferases.
  • [SW|HTH gntR-type domain] (aa 1-69) (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|4MGR] ([protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR], 27% identity) [pubmed|24127574]
  • Biological materials

    Mutant

  • BKE03560 ([gene|3A756A845ADA88DA569FA9A1B484DA43A28C6F4D|ycxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTCTCCCCCTGTTT, downstream forward: _UP4_GGTGTCAAGCTGTTGATGAG
  • BKK03560 ([gene|3A756A845ADA88DA569FA9A1B484DA43A28C6F4D|ycxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTCTCCCCCTGTTT, downstream forward: _UP4_GGTGTCAAGCTGTTGATGAG
  • References

  • 11756427,22020104,24127574