SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glycogen phosphorylase
91.56 kDa
protein length
798 aa Sequence Blast
gene length
2394 bp Sequence Blast
glycogen biosynthesis
glycogen phosphorylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of glycogen]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,163,735 → 3,166,131

    The protein

    Catalyzed reaction/ biological activity

  • [(1→4)-α-D-glucosyl](n) + phosphate --> [(1→4)-α-D-glucosyl](n-1) + α-D-glucose 1-phosphate (according to UniProt)
  • Protein family

  • glycogen phosphorylase family (single member, according to UniProt)
  • Modification

  • phosphorylation on (Thr-291 OR Ser-294) [Pubmed|17218307]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1PYG] (from Oryctolagus cuniculus, 45% identity) [pubmed|1962195]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8145641], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8145641]
  • view in new tab

    Biological materials


  • BKE30940 (Δ[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAAATAAGTCTGCAAAGC, downstream forward: _UP4_TGAAAAAGCCGCTGTATAAG
  • BKK30940 (Δ[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAAATAAGTCTGCAAAGC, downstream forward: _UP4_TGAAAAAGCCGCTGTATAAG
  • References

  • 17218307,8145641,1962195