SubtiBank SubtiBank
yjmC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjmC

similar to ureidoglycolate dehydrogenase, may be involved in galacturonate utilization
locus
BSU_12320
pI
5.67
mw
36.32 kDa
protein length
337 aa Sequence Blast
gene length
1014 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,303,423 1,304,436

    The protein

    Protein family

  • LDH2/MDH2 oxidoreductase family (single member, according to UniProt)
  • Structure

  • [PDB|4H8A] (ureidoglycolate dehydrogenase from E. coli, 41% identity) [pubmed|23284870]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of malate dehydrogenase EC 1.1.1.37. but it is marked as uncharacterized oxidoreductase (EC 1.1.1.-) in Swiss-Prot. In MetaCyc it is marked as similar to malate dehydrogenase. As the paper by Mekjian et al. [Pubmed|9882655] suggests this gene is more likely to be involved in the glucuronate pathway (for which EC 1.1.1.37 is not a member), no literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,9882655], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    genes
    [gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A367 (yjmC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/367 NBRP B. subtilis, Japan]
  • BKE12320 ([gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCAAGTGCCTCCTTCCT, downstream forward: _UP4_TTCTTAAAAAGCAGGTGAGT
  • BKK12320 ([gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCAAGTGCCTCCTTCCT, downstream forward: _UP4_TTCTTAAAAAGCAGGTGAGT
  • References

  • 9579062,9882655,10666464,19935659,27941785,23284870