SubtiBank SubtiBank
yjmC [2019-06-27 15:26:09]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjmC [2019-06-27 15:26:09]

similar to ureidoglycolate dehydrogenase, may be involved in galacturonate utilization
36.32 kDa
protein length
337 aa Sequence Blast
gene length
1014 bp Sequence Blast

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of hexuronate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,303,423 1,304,436

    The protein

    Protein family

  • LDH2/MDH2 oxidoreductase family (according to Swiss-Prot)
  • Structure

  • [PDB|4H8A] (ureidoglycolate dehydrogenase from E. coli, 41% identity) [pubmed|23284870]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of malate dehydrogenase EC but it is marked as uncharacterized oxidoreductase (EC 1.1.1.-) in Swiss-Prot. In MetaCyc it is marked as similar to malate dehydrogenase. As the paper by Mekjian et al. [Pubmed|9882655] suggests this gene is more likely to be involved in the glucuronate pathway (for which EC is not a member), no literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,9882655], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials


  • MGNA-A367 (yjmC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12320 ([gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCAAGTGCCTCCTTCCT, downstream forward: _UP4_TTCTTAAAAAGCAGGTGAGT
  • BKK12320 ([gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCAAGTGCCTCCTTCCT, downstream forward: _UP4_TTCTTAAAAAGCAGGTGAGT
  • References

  • 9579062,9882655,10666464,19935659,27941785,23284870