SubtiBank SubtiBank
yqfT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqfT

unknown
locus
BSU_25120
pI
9.80
mw
9.60 kDa
protein length
gene length
255 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,593,000 2,593,254

    Expression and Regulation

    Operons

    genes
    [gene|3B33902467FEB7C3444853E1BB7A7501574C6A06|yqfT]
    description
    [Pubmed|12486072]
    view in new tab

    Biological materials

    Mutant

  • BKE25120 ([gene|3B33902467FEB7C3444853E1BB7A7501574C6A06|yqfT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCATTCCACCTCCA, downstream forward: _UP4_TAAAAAATGGGGGTGTTATC
  • BKK25120 ([gene|3B33902467FEB7C3444853E1BB7A7501574C6A06|yqfT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCATTCCACCTCCA, downstream forward: _UP4_TAAAAAATGGGGGTGTTATC
  • References

  • 12486072