SubtiBank SubtiBank
phrG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phrG

response regulator aspartate phosphatase (RapG) regulator
locus
BSU_40310
pI
9.02
mw
4.04 kDa
protein length
gene length
117 bp Sequence Blast
function
control of DegU activity
product
phosphatase (RapG) regulator
essential
no
synonyms
yycL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    4,141,358 4,141,474

    The protein

    Catalyzed reaction/ biological activity

  • binds to [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|RapG], this results in the inability of [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|RapG] to interact with [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|12950930]
  • Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]-[gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]
    description
    [Pubmed|12950930]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16553878], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|12950930], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (4.8-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B822 (yycL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1821 NBRP B. subtilis, Japan]
  • BKE40310 ([gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGCCAATCAGAAATCTTT, downstream forward: _UP4_TAAATGAAAAACCCCCGCGG
  • BKK40310 ([gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGCCAATCAGAAATCTTT, downstream forward: _UP4_TAAATGAAAAACCCCCGCGG
  • References

  • 16553878,12850135,12950930