SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


class B penicillin-binding protein PBP 2A, required for [SW|cell wall synthesis] during cell elongation, part of the [protein|search|Rod complex] for lateral [SW|cell wall synthesis] and control of cell diameter
79.96 kDa
protein length
716 aa Sequence Blast
gene length
2151 bp Sequence Blast
formation of a rod-shaped peptidoglycan cell wall, spore outgrowth
penicillin-binding protein PBP 2A

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,581,771 2,583,921

    The protein

    Catalyzed reaction/ biological activity

  • required for [SW|cell wall synthesis] during cell elongation [Pubmed|12896990]
  • driver of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] dynamics [Pubmed|21636744,21636745]
  • Protein family

  • [SW|transpeptidase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|883DFF72888D280A102E53CC1D69A8B1C7BE2907|PbpH]
  • Structure

  • [PDB|3VSK] (from Staphylococcus aureus, 45% identity) [pubmed|22846910]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • during vegetative growth: evenly distributed along the membrane [pubmed|14731276]
  • localization depends on the availability of peptidoglyan precursors (lipid II) [Pubmed|23895585]
  • Expression and Regulation



    additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-C461 (yqgF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE25000 ([gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCACCTTTTCTAT, downstream forward: _UP4_TAAAAAAAAACGCTCACATG
  • BKK25000 ([gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCACCTTTTCTAT, downstream forward: _UP4_TAAAAAAAAACGCTCACATG
  • GFP fusion

  • 3103 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]::pSG5043 (cat Pxyl-gfpa-[gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]1-804) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jeff Errington] lab
  • labs

  • [SW|Jeff Errington], Newcastle University, UK [ homepage]
  • References

  • 9851991,9139922,12896990,18957862,20487272,21636744,21636745,21815947,23895585,22846910,14731276,31086310,32152588