SubtiBank SubtiBank
pspA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pspA

phage shock protein A homolog
locus
BSU_06180
pI
5.78
mw
24.99 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ydjF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    671,245 671,928

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • PspA/IM30 family (with [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH], according to UniProt)
  • Paralogous protein(s)

  • [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH]
  • Structure

  • [PDB|4WHE] (from E. coli, 34% identity, corresponds to aa 1 ... 133) [pubmed|26235546]
  • [SW|Localization]

  • cytoplasma (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]-[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]-[gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]-[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]
    description
    [Pubmed|11454200]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11454200], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C430 (yqgI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2428 NBRP B. subtilis, Japan]
  • BKE06180 ([gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGTTCCTCCTAA, downstream forward: _UP4_TAATACATAGGAGGCCGCAG
  • BKK06180 ([gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGTTCCTCCTAA, downstream forward: _UP4_TAATACATAGGAGGCCGCAG
  • References

    Reviews

  • 27297125
  • Original publications

  • 11454200,18840696,22926563,23980836,27791134,26235546